Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1039360
End position: 1039383
Length: 24

DNA sequence
>NC_021663, from 1039360 to 1039383 (24 bp); Corynebacterium terpenotabidum Y-11 ACGCCGACGCGGTCGCCGACGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1038574-1039650	Sequence	A606_04435 - alcohol dehydrogenase (Protein is coded in complementary strand; from 1039650 to 1038574)