Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1513744
End position: 1513767
Length: 24

DNA sequence
>NC_021663, from 1513744 to 1513767 (24 bp); Corynebacterium terpenotabidum Y-11 GTCGTTGTCGTGCTCGTTGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1510994-1514221	Sequence	A606_06520 - cell division protein (Protein is coded in complementary strand; from 1514221 to 1510994)