Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1942928
End position: 1942951
Length: 24

DNA sequence
>NC_021663, from 1942928 to 1942951 (24 bp); Corynebacterium terpenotabidum Y-11 GCCGGCGTCGGCGCAGGCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1941099-1943243	Sequence	A606_08415 - acyl-CoA carboxylase subunit alpha (Protein is coded in complementary strand; from 1943243 to 1941099)