Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 379596
End position: 379619
Length: 24

DNA sequence
>NC_021663, from 379596 to 379619 (24 bp); Corynebacterium terpenotabidum Y-11 ACGGCCACGACCAGGGCCACGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 379065-379805	Sequence	A606_01550 - ABC transporter permease (Protein is coded in complementary strand; from 379805 to 379065)