Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 767284
End position: 767307
Length: 24

DNA sequence
>NC_021663, from 767284 to 767307 (24 bp); Corynebacterium terpenotabidum Y-11 GTCGGCACCTCGGCACCTCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 766837-767292	Sequence	A606_03280 - tyrosine recombinase (Protein is coded in complementary strand; from 767292 to 766837)
ORF. 767214-767789	Sequence	A606_03285 - Integrase catalytic region (Protein is coded in complementary strand; from 767789 to 767214)