Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1403836
End position: 1403862
Length: 27

DNA sequence
>NC_021663, from 1403836 to 1403862 (27 bp); Corynebacterium terpenotabidum Y-11 CGGCGTCCCCGGCGTCCCCGGCGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1403202-1404584	Sequence	A606_06015 - recombination factor protein RarA (Protein is coded in complementary strand; from 1404584 to 1403202)