Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1690015
End position: 1690041
Length: 27

DNA sequence
>NC_021663, from 1690015 to 1690041 (27 bp); Corynebacterium terpenotabidum Y-11 CGTCCGCTGCGTCCGCTGCGTCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1689225-1690250	Sequence	A606_07220 - hypothetical protein (Protein is coded in complementary strand; from 1690250 to 1689225)