Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1998265
End position: 1998291
Length: 27

DNA sequence
>NC_021663, from 1998265 to 1998291 (27 bp); Corynebacterium terpenotabidum Y-11 CACATCCGGCAGATCCGGCAGATCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1996085-1999450	Sequence	A606_08610 - hypothetical protein (Protein is coded in complementary strand; from 1999450 to 1996085)