Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1999454
End position: 1999480
Length: 27

DNA sequence
>NC_021663, from 1999454 to 1999480 (27 bp); Corynebacterium terpenotabidum Y-11 GTGCCCGTCCTGCCCGTCCTGCCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1999422-2000465	Sequence	A606_08615 - hypothetical protein (Protein is coded in complementary strand; from 2000465 to 1999422)