Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2241412
End position: 2241438
Length: 27

DNA sequence
>NC_021663, from 2241412 to 2241438 (27 bp); Corynebacterium terpenotabidum Y-11 TGCTCGCTGTGCTCGCTGTGCTCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2241183-2241449	Sequence	A606_09790 - isochorismatase (Protein is coded in complementary strand; from 2241449 to 2241183)