Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 229520
End position: 229546
Length: 27

DNA sequence
>NC_021663, from 229520 to 229546 (27 bp); Corynebacterium terpenotabidum Y-11 CCAGCTCCTCCAGCTCCTCCAGCCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 229283-230323	Sequence	A606_00930 - transposase for insertion sequence element (Protein is coded in complementary strand; from 230323 to 229283)