Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2310927
End position: 2310953
Length: 27

DNA sequence
>NC_021663, from 2310927 to 2310953 (27 bp); Corynebacterium terpenotabidum Y-11 CGGCCTTCTCGGCATTCTCGGCTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2310866-2311648	Sequence	A606_10105 - hypothetical protein (Protein is coded in complementary strand; from 2311648 to 2310866)