Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2323276
End position: 2323302
Length: 27

DNA sequence
>NC_021663, from 2323276 to 2323302 (27 bp); Corynebacterium terpenotabidum Y-11 TCGGCGACCTCAGCGACCTCAGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2322457-2323560	Sequence	A606_10160 - hypothetical protein (Protein is coded in complementary strand; from 2323560 to 2322457)