Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 234940
End position: 234966
Length: 27

DNA sequence
>NC_021663, from 234940 to 234966 (27 bp); Corynebacterium terpenotabidum Y-11 ACGGCGTCCCCGGCGTCCCCGGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 234763-235911	Sequence	A606_00955 - putative oxidoreductase (Protein is coded in complementary strand; from 235911 to 234763)