Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2403001
End position: 2403027
Length: 27

DNA sequence
>NC_021663, from 2403001 to 2403027 (27 bp); Corynebacterium terpenotabidum Y-11 GACGACCTTGACGACCTGGACAACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2402822-2403310	Sequence	A606_10510 - endoribonuclease (Protein is coded in complementary strand; from 2403310 to 2402822)