Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2472657
End position: 2472683
Length: 27

DNA sequence
>NC_021663, from 2472657 to 2472683 (27 bp); Corynebacterium terpenotabidum Y-11 CCGGCGACTCCAGCGACTCCAGCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2472173-2474683	Sequence	A606_10750 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 2474683 to 2472173)