Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2557243
End position: 2557269
Length: 27

DNA sequence
>NC_021663, from 2557243 to 2557269 (27 bp); Corynebacterium terpenotabidum Y-11 TTCGGCGGCATCGGCGGCATCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556614-2558968	Sequence	A606_11115 - hypothetical protein (Protein is coded in complementary strand; from 2558968 to 2556614)