Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2656102
End position: 2656128
Length: 27

DNA sequence
>NC_021663, from 2656102 to 2656128 (27 bp); Corynebacterium terpenotabidum Y-11 GCCGGCCGGGCCGGCCGGGCCGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2656100-2657101	Sequence	A606_11540 - hypothetical protein (Protein is coded in complementary strand; from 2657101 to 2656100)