Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2666302
End position: 2666328
Length: 27

DNA sequence
>NC_021663, from 2666302 to 2666328 (27 bp); Corynebacterium terpenotabidum Y-11 CGGCGGCCTCGGCGTCCTCGGCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2666235-2668151	Sequence	A606_11585 - hypothetical protein (Protein is coded in complementary strand; from 2668151 to 2666235)