Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 62337
End position: 62363
Length: 27

DNA sequence
>NC_021663, from 62337 to 62363 (27 bp); Corynebacterium terpenotabidum Y-11 GGGGCTGCGGGTGCTGCGGGTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 62265-63506	Sequence	A606_00270 - hypothetical protein (Protein is coded in complementary strand; from 63506 to 62265)