Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 660181
End position: 660207
Length: 27

DNA sequence
>NC_021663, from 660181 to 660207 (27 bp); Corynebacterium terpenotabidum Y-11 ACCCCGGAAGCCCCGGAAGCCCCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 659983-660909	Sequence	A606_02820 - hypothetical protein (Protein is coded in complementary strand; from 660909 to 659983)