Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 755713
End position: 755739
Length: 27

DNA sequence
>NC_021663, from 755713 to 755739 (27 bp); Corynebacterium terpenotabidum Y-11 CCGGTCTCGCCGATCTCGCCGGTCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 754813-756930	Sequence	A606_03215 - ATP-dependent DNA helicase (Protein is coded in complementary strand; from 756930 to 754813)