Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 766202
End position: 766228
Length: 27

DNA sequence
>NC_021663, from 766202 to 766228 (27 bp); Corynebacterium terpenotabidum Y-11 GGTGCCGGTGGTACCGGTGGTACCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 766173-766655	Sequence	A606_03275 - hypothetical protein (Protein is coded in complementary strand; from 766655 to 766173)