Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 79438
End position: 79464
Length: 27

DNA sequence
>NC_021663, from 79438 to 79464 (27 bp); Corynebacterium terpenotabidum Y-11 TGTGCCGGATGTGTCGGAGGTGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 79028-80743	Sequence	A606_00315 - hypothetical protein (Protein is coded in complementary strand; from 80743 to 79028)