Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 846118
End position: 846144
Length: 27

DNA sequence
>NC_021663, from 846118 to 846144 (27 bp); Corynebacterium terpenotabidum Y-11 GTGCCCTTAGTGCCCTCAGTGCCCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 846143-847057	Sequence	A606_03625 - hypothetical protein (Protein is coded in complementary strand; from 847057 to 846143)