Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2456209
End position: 2456238
Length: 30

DNA sequence
>NC_021663, from 2456209 to 2456238 (30 bp); Corynebacterium terpenotabidum Y-11 CGGCACCAGCACCCGCACCGGCACCCGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2456088-2456690	Sequence	A606_10710 acpS 4'-phosphopantetheinyl transferase (Protein is coded in complementary strand; from 2456690 to 2456088)