Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2480293
End position: 2480322
Length: 30

DNA sequence
>NC_021663, from 2480293 to 2480322 (30 bp); Corynebacterium terpenotabidum Y-11 CGGCGACGGCGACGGGGACGGTGACGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2478312-2480390	Sequence	A606_10770 nadE NAD synthetase (Protein is coded in complementary strand; from 2480390 to 2478312)