Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 100451
End position: 100483
Length: 33

DNA sequence
>NC_021663, from 100451 to 100483 (33 bp); Corynebacterium terpenotabidum Y-11 TCGTCACTGCCGGGTCACTGCCGGGTCACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 100466-101989	Sequence	A606_00425 - DNA-binding transcription regulator (Protein is coded in complementary strand; from 101989 to 100466)