Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1519668
End position: 1519700
Length: 33

DNA sequence
>NC_021663, from 1519668 to 1519700 (33 bp); Corynebacterium terpenotabidum Y-11 GGCCGTTGACTGGTAGTTGACTAGACGTTGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1519700-1521988	Sequence	A606_06550 - polynucleotide phosphorylase/polyadenylase (Protein is coded in complementary strand; from 1521988 to 1519700)