Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1222863
End position: 1222898
Length: 36

DNA sequence
>NC_021663, from 1222863 to 1222898 (36 bp); Corynebacterium terpenotabidum Y-11 CGGTGCGCAGATCGGTGAGCGGATCGGTGAGCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1221893-1222912	Sequence	A606_05230 mmuM homocysteine methyltransferase (Protein is coded in complementary strand; from 1222912 to 1221893)