Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1379657
End position: 1379692
Length: 36

DNA sequence
>NC_021663, from 1379657 to 1379692 (36 bp); Corynebacterium terpenotabidum Y-11 GATCGTGTCGGAGATCGCGTCGCAGATCTTGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1378521-1379738	Sequence	A606_05905 - S-adenosylmethionine synthetase (Protein is coded in complementary strand; from 1379738 to 1378521)