Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1546556
End position: 1546591
Length: 36

DNA sequence
>NC_021663, from 1546556 to 1546591 (36 bp); Corynebacterium terpenotabidum Y-11 CCCGCTGTCCGACTCGCTGCCCGACCCGCTGCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1546410-1547867	Sequence	A606_06665 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 1547867 to 1546410)