Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1614351
End position: 1614386
Length: 36

DNA sequence
>NC_021663, from 1614351 to 1614386 (36 bp); Corynebacterium terpenotabidum Y-11 CGCCGCGATGGTCGCAGCGATCGTCGCCGCGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1612006-1614417	Sequence	A606_06905 - hypothetical protein (Protein is coded in complementary strand; from 1614417 to 1612006)