Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1678610
End position: 1678645
Length: 36

DNA sequence
>NC_021663, from 1678610 to 1678645 (36 bp); Corynebacterium terpenotabidum Y-11 CCCCGGCCCACCCGGCCCACCCGGCCCACCCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1678477-1678668	Sequence	A606_07180 - hypothetical protein (Protein is coded in complementary strand; from 1678668 to 1678477)