Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1968618
End position: 1968653
Length: 36

DNA sequence
>NC_021663, from 1968618 to 1968653 (36 bp); Corynebacterium terpenotabidum Y-11 CCGACTCCTCGCCCGACTCTTCGCCCGACTCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1968473-1970134	Sequence	A606_08520 - hypothetical protein (Protein is coded in complementary strand; from 1970134 to 1968473)