Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1972159
End position: 1972194
Length: 36

DNA sequence
>NC_021663, from 1972159 to 1972194 (36 bp); Corynebacterium terpenotabidum Y-11 CCCAGCATCCCCTGCATCCCCGGCATCCCCGGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1971395-1974205	Sequence	A606_08530 - ATP-dependent DNA helicase II (Protein is coded in complementary strand; from 1974205 to 1971395)