Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2020842
End position: 2020877
Length: 36

DNA sequence
>NC_021663, from 2020842 to 2020877 (36 bp); Corynebacterium terpenotabidum Y-11 GTGTCGTCTGTGTCGCCTGTGTCGCCTGTGTCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2020680-2022938	Sequence	A606_08720 - two-component system sensor kinase (Protein is coded in complementary strand; from 2022938 to 2020680)