Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2389991
End position: 2390026
Length: 36

DNA sequence
>NC_021663, from 2389991 to 2390026 (36 bp); Corynebacterium terpenotabidum Y-11 GATCTGCGGCCAGATCAGCAGCCAGATCTGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2389687-2390877	Sequence	A606_10440 - hypothetical protein (Protein is coded in complementary strand; from 2390877 to 2389687)