Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2559005
End position: 2559040
Length: 36

DNA sequence
>NC_021663, from 2559005 to 2559040 (36 bp); Corynebacterium terpenotabidum Y-11 GCACTTGCTGCGGCACTTGCTGCACCACCTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2558965-2560158	Sequence	A606_11120 - hypothetical protein (Protein is coded in complementary strand; from 2560158 to 2558965)