Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2640378
End position: 2640413
Length: 36

DNA sequence
>NC_021663, from 2640378 to 2640413 (36 bp); Corynebacterium terpenotabidum Y-11 GGACTCGGTGGTGGATTCGGTGGTGGACTCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2639644-2640741	Sequence	A606_11455 - hypothetical protein (Protein is coded in complementary strand; from 2640741 to 2639644)