Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2680419
End position: 2680454
Length: 36

DNA sequence
>NC_021663, from 2680419 to 2680454 (36 bp); Corynebacterium terpenotabidum Y-11 CGGTGGCGGGGTCGGTGGCGGGCTCGTTGGCGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2679908-2680477	Sequence	A606_11630 - putative ribosomal protein N-acetylase (Protein is coded in complementary strand; from 2680477 to 2679908)