Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 331610
End position: 331645
Length: 36

DNA sequence
>NC_021663, from 331610 to 331645 (36 bp); Corynebacterium terpenotabidum Y-11 ATAGCCGTCGTCGTAGCCGTCGTCATAGCCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 331545-332450	Sequence	A606_01335 - hypothetical protein (Protein is coded in complementary strand; from 332450 to 331545)