Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 338654
End position: 338689
Length: 36

DNA sequence
>NC_021663, from 338654 to 338689 (36 bp); Corynebacterium terpenotabidum Y-11 GAGGAATCAGAGGAATCAGCGGAATCAGAGGAATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 336062-338800	Sequence	A606_01355 - hypothetical protein (Protein is coded in complementary strand; from 338800 to 336062)