Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 388094
End position: 388129
Length: 36

DNA sequence
>NC_021663, from 388094 to 388129 (36 bp); Corynebacterium terpenotabidum Y-11 TTGCCGTTGCCGCCGCCGTTGCCGTTGCCGGTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 387485-388351	Sequence	A606_01590 - hypothetical protein (Protein is coded in complementary strand; from 388351 to 387485)