Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 440993
End position: 441028
Length: 36

DNA sequence
>NC_021663, from 440993 to 441028 (36 bp); Corynebacterium terpenotabidum Y-11 CGGAGGCACCAGAGGCACCGGGGGCACCGGGGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 440893-441723	Sequence	A606_01800 - exodeoxyribonuclease III (Protein is coded in complementary strand; from 441723 to 440893)