Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 644721
End position: 644756
Length: 36

DNA sequence
>NC_021663, from 644721 to 644756 (36 bp); Corynebacterium terpenotabidum Y-11 TCAGCGGTTCGGGCAGCGGTTCGGGCAGCGGTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 644715-646310	Sequence	A606_02750 - hypothetical protein (Protein is coded in complementary strand; from 646310 to 644715)