Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 707171
End position: 707206
Length: 36

DNA sequence
>NC_021663, from 707171 to 707206 (36 bp); Corynebacterium terpenotabidum Y-11 ACAACGCTGCCTACAACGCTGTCTACAACGCTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 707206-709656	Sequence	A606_03000 - glycogen/starch/alpha-glucan phosphorylase (Protein is coded in complementary strand; from 709656 to 707206)