Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 720608
End position: 720643
Length: 36

DNA sequence
>NC_021663, from 720608 to 720643 (36 bp); Corynebacterium terpenotabidum Y-11 CCCGGCCCGACGCCCGGGCCGGCGCCCGGCCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 720368-721306	Sequence	A606_03055 - MarR DNA-binding transcription regulator (Protein is coded in complementary strand; from 721306 to 720368)