Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 97686
End position: 97721
Length: 36

DNA sequence
>NC_021663, from 97686 to 97721 (36 bp); Corynebacterium terpenotabidum Y-11 CGAGGCACCTGGCCAGGCACCTGACCGGGCACCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 97155-97775	Sequence	A606_00410 - hypothetical protein (Protein is coded in complementary strand; from 97775 to 97155)