Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1241149
End position: 1241187
Length: 39

DNA sequence
>NC_021663, from 1241149 to 1241187 (39 bp); Corynebacterium terpenotabidum Y-11 GTTACCGGGCGCTGTCACCGGGCACTGTCACCGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1241177-1242751	Sequence	A606_05320 - multifunctional thiamine-phosphate pyrophosphorylase/synthase/phosphomethylpyrimidine kinase (Protein is coded in complementary strand; from 1242751 to 1241177)